Abstract
Abstract
Maternal gut microbiome impairment has garnered attention for its potential role in influencing neurodevelopmental outcomes in offspring, especially in situations that increase brain vulnerability such as perinatal asphyxia (PA). Maternal microbiome and fetal brain interplay emerge as a critical link between maternal health and offspring neurodevelopment. This study aims to generate a model to assess the impact of maternal dysbiosis triggered by gestational antibiotic administration and PA on offspring neurodevelopment. Wistar rats were subjected to antibiotics in drinking water from the 11th gestational day until birth. On the 6th postnatal day, pups were subjected to PA/normoxia, resulting in four experimental groups: control-normoxia, antibiotics-normoxia, control-asphyxia, and antibiotics-asphyxia. Early-life behavioral tests were conducted between postnatal days 7 and 9. The initial antimicrobial cocktail (ampicillin, vancomycin, neomycin, clindamycin, amphotericin-B) led to an increased number of miscarriages, poor weight gain during pregnancy, reduced offspring weight, and changes in the maternal gut microbiome compared to control. Offspring presented impaired neurodevelopmental reflexes in both PA and antibiotic groups and increased hippocampal neuroinflammation. Due to these detrimental effects, a more pregnancy-safe antibiotic cocktail was used for a second experiment (ampicillin, vancomycin, neomycin, meropenem). This resulted in no miscarriages or pregnancy-weight loss but was still linked to gut microbiome disruption. PA impaired neurodevelopmental reflexes and increased neuroinflammation, effects amplified by antibiotic administration. These preliminary findings reveal the cumulative potential of maternal dysbiosis and PA on neurodevelopment impairment, emphasizing caution in gestational antimicrobial use. Further investigations should include offspring long-term follow-up and maternal behavior and integrate probiotics to counteract antibiotic effects.
Graphical abstract
Lay summary
This study investigates the impact of maternal gut microbiome disruptions caused by gestational antibiotic treatment and low oxygen exposure shortly after birth on the development of the rats’ babies. We found that both antibiotic exposure and reduced oxygen levels led to changes in early behavior and increased inflammation of the nervous tissue in the baby rats. Although using a different, potentially safer antibiotic combination reduced pregnancy complications, it still changed the bacteria in the mother’s gut and worsened early behavior. These findings show that antibiotics during pregnancy can affect the developing brain of baby rats and careful consideration should be used before prescribing them. Future research will explore longer-term effects and potential medicines.
Introduction
The gut microbiota represents a highly intricate ecosystem crucial for maintaining host homeostasis, influenced by various exogenous and intrinsic factors that are not yet fully understood. Dysbiosis, or gut microbial imbalance, has been implicated in several pathological conditions, highlighting the importance of maintaining eubiosis, or a balanced gut microbiota composition, through tailored dietary interventions and antibiotic treatments (Dudek-Wicher et al. 2018).
Parturition is accompanied by a transient period of asphyxia characterized by hypoxia and hypercapnia in the neonate, constituting a normal physiological response to birth stress. However, prolonged birth asphyxia, resulting from extended labor or umbilical occlusion, can lead to severe short- and long-term consequences, particularly affecting the vulnerable and hypoxia-sensitive immature brain (Gillam-Krakauer et al. 2024). Perinatal asphyxia (PA) is a significant contributor to neonatal and childhood mortality and morbidity worldwide, particularly associated with conditions such as hypoxic-iIschemic encephalopathy (HIE), predisposing individuals to neurological and psychiatric disorders (Lawn et al. 2011).
Maternal factors, such as diets, play a role in modulating the severity and impact of PA. A high-fat diet has been found to increase neonatal susceptibility (Isac et al. 2018), while supplementing with certain nutrients like trans-resveratrol and citicoline has neuroprotective effects (Isac et al. 2017, Isac et al. 2020). Considering the pivotal role of diet in shaping the diversity and composition of the gut microbiota, we hypothesize that the maternal gut microbiome plays a significant role in determining the vulnerability of the offspring's immature brain to PA.
The gut microbiota and the brain undergo rapid and parallel maturation during early development, with significant interactions between them. The notion that maternal gut bacteria can influence both the development of the infant’s brain and their gut microbiota during pregnancy has been proposed (Codagnone et al. 2019). Alterations in the maternal gut microbiome due to factors such as infection (Kim et al. 2017), dietary changes (Ionescu et al. 2024), stress (Golubeva et al. 2015), and antibiotic therapy (Vuong et al. 2020), have been associated with abnormalities in offspring brain function and behavior yet the exact mechanism is not clear. Furthermore, the concept of an in utero or fetal microbiome has been significantly challenged hence direct microbial effects on the offspring during pregnancy are unlikely yet there is scope for circulating metabolites (Kennedy et al. 2023).
Epidemiological studies have shown that early-life exposure to antibiotics can increase the risk of developing immune and metabolic diseases (Lamont et al. 2020). In rodents, antibiotic administration to dams results in behavior deficits in the offspring, but with conflicting outcomes regarding activity, social interactions, and anxiety (O’Connor et al. 2021). Also, the expression of genes associated with axonogenesis is impaired in mouse embryos from antibiotic-treated and germ-free dams leading to altered neurodevelopment and behavior (Vuong et al. 2020).
Germ-free animal models have been instrumental in elucidating the gut microbiome's influence on the brain, but they lack clinical relevance. Therefore, using orally administered antibiotics to induce dysbiosis in holoxenic animals provides a more translational approach to studying the effects of the intestinal microbiome on neurodevelopment (Kennedy et al. 2018). Although a couple of studies explored the influence of maternal antibiotic-mediated dysbiosis on the offspring’s behavior and neurodevelopment, no studies have created a reproducible model to study maternal antibiotic-mediated dysbiosis in PA.
The novelty of our model relies on the association of two common conditions: (i) maternal gut microbiome disruption during pregnancy, which is known to impact the offspring’s neurological function and structure; (ii) the transient period of asphyxia that accompanies parturition. This is the first endeavor to create an experimental in vivo model that investigates the influence of maternal gut microbiota antibiotic disruption on the offspring’s brain tolerance to PA.
Materials and methods
Animals
The experiments were conducted on Wistar rats provided with access to a standard diet and water ad libitum. All animal procedures were carried out with the approval of the local ethics committee for animal research following the European Communities Council Directive 86/609/EEC on the protection of animals used for scientific purposes and approved by the Animal Experimentation Ethics Committee of Cantacuzino National Military Medical Institute for Research and Development (37/23.08.2023) and of Carol Davila University of Medicine and Pharmacy (21994/02.08.2022). The rats (aged 90–100 days) were brought in and mated in our Biological Services Unit (Cernica Biological Service Unit of Cantacuzino National Military Medical Institute for Research and Development and the Biological Service Unit of Carol Davila University of Medicine and Pharmacy). The number of used rats varied based on the experiment.
For experiment 1, 39 female rats (15 control group, 24 antibiotic group) were mated with 6 male rats, and treated with a first antibiotic cocktail starting with the gestational day 10–11, as appointed by an experienced veterinary doctor, until birth. Of the 39 female rats, 26 gave birth to live pups, 14 from the control group, and 12 from the antibiotic group. Subsets of the litter were exposed to asphyxia or normoxia, and the whole litter of pups was either sacrificed for further sample analysis or subjected to neurodevelopmental reflexes.
For experiment 2, 8 female Wistar rats (4 control group, 4 antibiotic group) were mated with 4 male Wistar rats. The gestational day 0 was considered based on the vaginal plug visualization, and treatment with a second antibiotic cocktail started at gestational day 10–11 until birth. After birth, part of the litter was exposed to asphyxia or normoxia, and part of the litter was sacrificed or subjected to neurodevelopmental reflexes. The overall experimental design is illustrated in Fig. 1.
Flowchart of the overall experimental design. E, embryonic day; GAA, gestational antibiotic administration; P, postnatal day.
Citation: Reproduction and Fertility 5, 4; 10.1530/RAF-24-0050
Gestational antimicrobial administration
Experiment 1: gestational antimicrobial administration-1 (GAA-1)
To efficiently deplete the gut microbiota during pregnancy a cocktail of antibiotics (ampicillin 1 mg/mL, vancomycin 1 mg/mL, neomycin 5 mg/mL, clindamycin 1 mg/mL) was orally administered in the drinking water, as modified after previous studies in the literature (Lamousé-Smith et al. 2011, Bookstaver et al. 2015, Desbonnet et al. 2015, Fröhlich et al. 2016, Tochitani et al. 2016, Nyangahu et al. 2018, Vuong et al. 2020, O’Connor et al. 2021, Bongers et al. 2022, Faas et al. 2023). Due to the bitter taste of metronidazole, this antibiotic was switched to clindamycin (Lamousé-Smith et al. 2011, Reikvam et al. 2011, Bongers et al. 2022). Among the antibiotics used, neomycin and vancomycin have low oral bioavailability, potentially reducing systemic toxicity (Fröhlich et al. 2016, de Bruijn et al. 2020). Additionally, ampicillin and vancomycin have been deemed safe for use during gestation (Bookstaver et al. 2015). To prevent fungal growth, amphotericin-B 0.1 mg/mL was also added to the antibiotic cocktail (Desbonnet et al. 2015), completing the first gestational antimicrobial combination. Due to its insolubility in water (Adediran et al. 2009), amphotericin-B was diluted using a small amount of dimethyl sulfoxide (DMSO) solvent, resulting in a final DMSO concentration of 1%, deemed to be safe (Hoyberghs et al. 2021).
Experiment 2: gestational antibiotic administration-2 (GAA-2)
To address the adverse effects observed in dams receiving GAA-1, such as elevated incidence of miscarriages and low offspring weight, we undertook refinement of the antibiotic cocktail. Given the conflicting evidence in the literature regarding the teratogenic potential of Amphotericin-B (Khosravi et al. 2022) and DMSO (Cheng et al. 2022), and the high oral bioavailability of clindamycin (Batzias et al. 2005), these were omitted from GAA-2 formulation. In the previous study that used this antifungal supplementation, the antibiotic cocktail was administered for a long period (60 days) (Desbonnet et al. 2015). Therefore, due to the short antibiotic administration in our study, we stopped administering the amphotericin-B. Furthermore, aiming for antibiotics with a greater impact on the gut microbiome, we replaced clindamycin, known for its high oral bioavailability, with meropenem, which exhibits lower oral bioavailability (Raza et al. 2021). Consequently, the revised antibiotic cocktail was composed of ampicillin (1 mg/mL), vancomycin (0.5 mg/mL), neomycin (5 mg/mL), and meropenem (1 mg/mL) (Fröhlich et al. 2016, O’Connor et al. 2021, Deng et al. 2023, Faas et al. 2023).
The treatment for both experiments was given starting approximately with gestational day 11, which corresponds to the neural tube formation in rats (Semple et al. 2013) until birth. The water was changed every 2 days for experiment 1 and daily for experiment 2. To advance our investigation into probiotic supplementation, we opted to administer the GAA-2 regimen during nighttime (16:00 h – 08:00 h), reserving the daytime period for probiotic intervention, a model developed after a previous study (Leclercq et al. 2017).
Maternal weights were measured regularly and glucose levels were determined close to the birth date. Liquid intake was estimated by measuring bottle weights before replenishment. Water intake in each cage was closely monitored to ascertain no notable variances among the treatment groups.
Perinatal asphyxia exposure
After birth, pups were divided into two groups: control (C) and antibiotic (AB) with pups coming from at least 2 litters/group. On postnatal day (P) 6, whole litters of pups (C and AB) were assigned either to the normoxia group (N) or perinatal asphyxia group (PA) by selecting them randomly from different females. Using a birth asphyxia paradigm developed by Helmy (Helmy et al. 2012) and further modified by our group, pups were exposed for 90 min to either normoxia or asphyxia (9% O2, 20% CO2 in N2) (Panaitescu et al. 2018). An open non-rebreathing system delivered the asphyxia gas combination at a constant flow rate of 2 L/min. The asphyxia exposure was assessed using a MouseOx monitor to dynamically collect the offspring’s vital signs and data regarding heart rate, arterial blood saturation, breath rate, and temperature during PA exposure. The temperature was maintained at 37°C during exposure using a heating pad (FHC Inc., Bowdoin, USA). All the pups were returned to their mothers immediately after exposure. The resulting four experimental groups were: control-normoxia (C-N), antibiotics-normoxia (AB-N), control-perinatal asphyxia (C-PA), and antibiotics-perinatal asphyxia (AB-PA).
Neurodevelopmental reflexes
To explore the early effects of antibiotics and asphyxia on offspring behavior, a subset of pups (males and females) underwent neurodevelopmental reflex testing from P7 to P9, while the others were sacrificed for further sample analysis. Given the limitations of exploring more complex behavior assessments at this developmental stage, the neurodevelopmental reflexes were investigated (Nguyen et al. 2017). No sex differences between the pups were observed at this stage.
Experiment 1 (GAA-1): Starting 24 h post-asphyxia, between P7 and P9, pups from each litter were subjected to early-life behavioral testing, including the righting reflex (RR), the negative geotactic reaction (NGR), the grip strength response (GSR), the cliff avoidance reflex (CAR), and the limbs grasping reflex (LGR).
The righting reflex (RR)
The neonate rat was placed on its back on a flat surface and the time required for the pup to right itself through 180° was measured. If necessary, each trial was allocated a maximum duration of 1 min, and the test was repeated three times, with the average time recorded (Nguyen et al. 2017).
The negative geotactic reaction (NGR)
The neonate pup was placed head down on a surface inclined at 45°. Each pup was observed for 180 s to turn and move toward the upper end of the surface. Motor and vestibular input is required for the mouse to recognize its orientation on a slope and turn around. The process was repeated for a total of three trials. Pups that didn’t turn or fell down the inclined plane were given a zero score (Ruhela et al. 2019).
The grip strength response (GSR)
For this test, a screen wire was used. Pups were placed on this screen at a horizontal level and allowed to accommodate for 5 s. Afterward, the screen was slowly inverted to 180°. The approximate angle of the screen was recorded when the pup fell. The procedure was repeated three times, and subsequently, the results were averaged (Feather-Schussler & Ferguson 2016).
The cliff avoidance reflex (CAR)
This test assesses the protective response of the pup when its snout and forepaw are placed on the edge of a flat surface. The pup was placed on a box with a flat elevated ledge, with only the digits of their forepaws and their snout positioned over the side. The duration required for the pup to turn away from the cliff while retracting its paws and snout away from the edge was used to calculate the score. The test was canceled if there was no response after 30 s. The procedure was repeated 3 times. There was no score if the pup didn’t move away from the cliff within 30 s (Nguyen et al. 2017).
The limbs grasping reflex (LGR)
This test was conducted by placing a blunt rod against the palm/planta of each forepaw, exerting light pressure. Grasping appeared as flexion of all digits around the rod. This test could be repeated until the appearance of the reflex (Nguyen et al. 2017). As it is a reflex, it is impossible to learn.
Experiment 2 (GAA-2):To refine and capture the most relevant data during the neonatal behavior assessments, we performed three selected neurodevelopmental reflex tests over 3 consecutive days, commencing 24 h post-asphyxia exposure. Given its subjective nature, we omitted the limbs grasping reflex test from our protocol. Instead, we retained the negative geotactic reaction and grip strength response tests, which yielded statistically significant results, along with the widely utilized righting reflex test.
Hippocampal tissue homogenate collection
At 24 h following asphyxia/normoxia exposure, subsets of offspring from all experimental cohorts were culled in accordance with animal ethical guidelines, and their hippocampi were dissected in ice-cold conditions, isolated from meningeal structures, and subsequently rinsed in ice-cold PBS (0.02 mol/L, pH = 7.0–7.2). The hippocampal tissue was then finely minced, homogenized using a glass homogenizer, subjected to sonication for 10 min, and centrifuged for 5 min at 5000 g and 4°C. Following centrifugation, the supernatant was carefully extracted and stored at −80°C until all samples were collected and prepared for analysis.
ELISA evaluation of neuroinflammatory and neural injury biomarkers
Using the ELISA technique performed on Multimodal Microplate Reader EnSight (Perkin Elmer) and following the manufacturer’s recommendations, the levels of TNF-α (Abcam ab100785), S-100B (Abcam ab234573), and total protein content (Lowry method) were determined in the hippocampal tissue homogenate. TNF-α and S-100B levels were quantified and expressed as ratios relative to the total protein content (pg/μg protein).
Maternal fecal collection and blood glucose levels during pregnancy
On gestational day 20 ± 1 days, fecal samples from the pregnant dams were collected and stored at −80°C until further analysis. Additionally, blood from the dams’ tail was collected during the antibiotic exposure and the glucose levels were checked.
Gut microbiome analysis
DNA extraction was conducted with the QIAamp DNA Stool Mini Kit (Qiagen) as per the manufacturer’s protocol. The concentration of DNA was determined using the Qubit Broad Range kit and the Qubit 4 fluorometer (Thermo Scientific). For quantitative Real-Time PCR analysis, microbial DNA samples were diluted to a concentration of 3 ng/μL. Bacterial group-specific 16S rRNA primers were employed for microbiota analysis via qRT-PCR, with primer sequences provided in Table 1. Each amplification reaction comprised 9 ng of DNA, 2.5 nM primers, and SYBR Green Master Mix (Applied Biosystems). Samples were analyzed using a ViiA7© Fast Real-Time instrument (Applied Biosystems).
Primer sequences 5′-3′ orientation.
| Bacteroides spp. | cctacgatggataggggtt |
| cacgctacttggctggttcag | |
| Butyricicoccus spp. | acctgaagaataagctcc |
| gataacgcttgctccctacgt | |
| BPP | ggtgtcggcttaagtgccat |
| cggacgtaagggccgtgc | |
| Lactobacillus spp. | acgagtagggaaatcttcca |
| caccgctacacatggag | |
| Fusobacterium spp. | acctaagggagaaacagaacca |
| cctgcctttaattcatctccat | |
| Faecalibacterium spp. | cccttcagtgccgcagt |
| gtcgcaggatgtcaagac | |
| Enterobacteriaceae | gtgccagcmgccgcggtaa |
| gcctcaagggcacaacctcc ag | |
| Sutterella spp. | cgcgaaaaaccttacctagcc |
| gacgtgtgaggccctagcc | |
| Bifidobacterium spp. | gggtggtaatgccggatg |
| ccaccgttacaccgggaa |
Statistical analysis
The data were analyzed using the statistical software package GraphPad Prism 9.0, and the results were presented as mean ± standard error of the mean (s.e.m.). Data were assessed for normality using the Shapiro–Wilk test. Normally distributed data were analyzed using a t-test or two-way ANOVA depending on the data, and non-normally distributed data were analyzed using the Mann–Whitney test. The threshold for statistical significance was set at a P-value of 0.05. The ‘n’ value represents the number of animals per experimental group.
Results
GAA-1 induces a detrimental reduced maternal weight gain throughout pregnancy with increased miscarriages, whereas GAA-2 does not exhibit a similar adverse impact
In experiment 1, GAA-1 resulted in a notable deviation from the expected weight trajectory during pregnancy, with a discernible decrease observed (pslope = −1.353, R2 = 0.010, P = 0.436) (Fig. 2A). Conversely, in experiment 2, GAA-2 administration did not elicit a similar effect, as dams exhibited a pattern of weight gain consistent with normal physiological expectations throughout the gestational period (pslope = 4.904, R2 = 0.195, P = 0.309) (Fig. 2B). The animals in the control group exhibited consistent weight gain throughout pregnancy.
The weight variation in dams exposed to gestational antibiotic administration during pregnancy: (A) In experiment 1, GAA-1 led to a slight decrease of weight during the pregnancy period (pslope = −1.353, R2 = 0.010, P = 0.436); (B) In experiment 2, GAA-2 led to a normal increase in dams’ weight during pregnancy (pslope = 4.904, R2 = 0.195, P = 0.309). The control group animals exhibited consistent weight gain throughout pregnancy. GAA, gestational antibiotic administration.
Citation: Reproduction and Fertility 5, 4; 10.1530/RAF-24-0050
The glucose levels in dams during pregnancy following antibiotic administration were modified differently in the two experiments. In experiment 1, after GAA-1 initiation, a reduction in glucose levels was observed compared to the control group (78.500 ± 11.480 mg/dL, n = 4 vs 99.880 ± 2.655 mg/dL, n = 8, *P = 0.015) (Fig. 3A). In experiment 2, GAA-2 did not significantly alter the glucose levels in dams compared to those in the control group (94.750 ± 12.950 mg/dL, n = 4 vs 105.8 ± 4.347 mg/dL, n = 4, P = 0.106) (Fig. 3B).
Glucose levels in dams collected during pregnancy, close to the birth date, after antibiotic initiation: (A) In experiment 1, GAA-1 (n = 4) led to a decrease in glucose levels when compared to the control group (n = 8, *P = 0.015); (B) In experiment 2, GAA-2 (n = 4) didn’t significantly impact the glucose levels in dams compared to the ones from the control group (n = 4, P = 0.106). Results are expressed as means ± SEM. *P < 0.05. GAA, gestational antibiotic administration.
Citation: Reproduction and Fertility 5, 4; 10.1530/RAF-24-0050
Prenatal administration of antimicrobials (GAA-1) resulted in a heightened incidence of miscarriages, observed at a rate of 50% (Fig. 4). Conversely, GAA-2 did not elicit a similar effect, as dams exhibited appropriate weight gain during pregnancy, and litters were characterized by a high number of pups (15 in the control group, 9 in the antibiotic group).
Offspring survival rates were compared between the two groups, control, and antibiotic, with the x-axis representing the number of animals. Administration of prenatal antimicrobials (GAA-1) resulted in a higher incidence of stillbirths, reaching 50%.
Citation: Reproduction and Fertility 5, 4; 10.1530/RAF-24-0050
GAA-1 leads to reduced weight in offspring relative to control
The assessment of offspring weight at P6 following GAA-1 was conducted to ascertain any discernible differences compared to the control cohort. Notably, GAA-1 exposure led to a statistically significant reduction in offspring weight (8.358 ± 0.340 g, n = 31) relative to the control group (11.65 ± 0.396 g, n = 31, ****P < 0.0001) (Fig. 5), indicating a tangible impact of the administered antibiotic regimen on postnatal growth. In experiment 2, GAA-2 did not induce any changes in the offspring weight (data not shown).
The offspring’s weight at postnatal day 6 after the GAA-1 compared to the control. GAA-1 significantly decreased the offspring weight (n = 31) compared to the control group (n = 31, ****P < 0.0001). No difference was observed for GAA-2 (data not shown). Results are expressed as means ± SEM. ****P < 0.0001. GAA, gestational antibiotic administration.
Citation: Reproduction and Fertility 5, 4; 10.1530/RAF-24-0050
Antibiotic administration during pregnancy alters the gut microbiome in dams
Experiment 1 (GAA-1)
In experiment 1, there were no considerable changes observed in the gut microbiome of the antibiotic-exposed rats compared to the control group, possibly attributed to the limited sample size (Fig. 6). However, the relative abundance of Enterobacteriaceae was notably elevated in the antibiotic-exposed group in comparison to the control group (*P = 0.038) (Fig. 6A). Intriguingly, the relative abundance of Faecalibacterium spp. was significantly higher in the antibiotic-exposed group compared to the control group (**P = 0.007) (Fig. 6C). Notably, the antibiotics’ administration did not appear to exert a substantial effect on the abundance of Lactobacillus spp. (Fig. 6B), likely due to the relatively modest available sample size. Furthermore, trends in relative abundances were discerned: antibiotic administration was associated with increased relative abundances of Fusobacterium spp. (Fig. 6D) and Bacteroides spp. (Fig. 6F), along with decreased levels of Butyricicoccus spp. (Fig. 6E), BPP (Fig. 6G), and Sutterella spp. (Fig. 6H) compared to control.
The relative abundance of (A) Enterobacteriaceae, (B) Lactobacillus spp., (C) Faecalibacterium spp., (D) Fusobacterium spp., (E) Butyricicoccus spp., (F) Bacteroides spp., (G) BPP (Bacteroides–Prevotella–Porphyromonas), (H) Sutterella spp. in AB group compared to C group in experiment 1. Results are expressed as means ± SEM. *P < 0.05, **P = 0.01–0.05.
Citation: Reproduction and Fertility 5, 4; 10.1530/RAF-24-0050
Experiment 2 (GAA-2)
In experiment 2, antibiotic exposure did not elicit substantial alterations in the gut microbiome, likely due to the limited sample size (Fig. 7). However, among the antibiotic-treated dams, the relative abundance of Fusobacterium was significantly higher compared to the control group (*P = 0.016) (Fig. 7E). Notably, antibiotic exposure did not significantly affect the levels of Lactobacillus (Fig. 7A), also possibly due to the constrained sample size utilized in the study. Furthermore, trends in the relative abundances of the antibiotic-treated group indicated reductions in the levels of Bifidobacterium spp. (Fig. 7B), Bacteroides spp. (Fig. 7C), Faecalibacterium spp. (Fig. 7D), and Butyricicoccus spp (Fig. 7F).
The relative abundance of (A) Lactobacillus spp., (B) Bifidobacterium spp., (C) Bacteroides spp., (D) Faecalibacterium spp., (E) Fusobacterium spp., (F) Butyricicoccus spp. in AB group compared to the C group in experiment 2 - preliminary results due to the low number of samples. Results are expressed as means ± SEM. *P < 0.05.
Citation: Reproduction and Fertility 5, 4; 10.1530/RAF-24-0050
Perinatal asphyxia results in impaired neonatal behavior, enhanced by prenatal antibiotic administration
Experiment 1 (GAA-1)
The righting reflex test: although not reaching statistical significance, offspring from the AB-N and AB-PA groups displayed prolonged correction times compared to the control groups, suggesting an overall impact of antibiotic administration (AB-N: 1.476 ± 0.202 sec, n = 5, AB-PA: 1.841 ± 0.313 sec, n = 8 vs C-N: 1.245 ± 0.138 sec, n = 8, C-PA: 1.148 ± 0.132 sec, n = 4, P > 0.05) (Fig. 8A). The negative geotactic reaction test: PA (P = 0.018) and AB (P = 0.0005) displayed significant main effects. The AB-PA group exhibited the longest latency to turn, followed by the AB-N group, in comparison to the control group (AB-PA: 25.052 ± 2.030 sec, n = 11, AB-N: 20.265 ± 2.396 sec, n = 8 vs C-N: 8.538 ± 0.849 sec, n = 4, P < 0.05) (Fig. 8B).
The impact of gestational antibiotic administration (GAA-1) on the offspring neurodevelopmental reflexes in experiment 1. A) In the Righting Reflex test, although not statistically significant, offspring from the AB-N (n = 5) and AB-PA (n = 8) groups exhibited an extended time to correct themselves compared to the remaining groups (C-N: n = 8, C-PA: n = 4). B) In the negative geotactic reaction test, significant main effects due to PA (P = 0.018) and AB (P = 0.0005) were noted; the AB-PA (n = 11) group demonstrated the longest latency to turn, followed by the AB-N (n = 8) group when compared to the C-N group (n = 4). C) In the grip strength response, a significant main effect of AB was found; offspring from the AB-N (n = 10) group displayed the weakest paw strength, followed by the AB-PA (n = 8) group compared to the C-N (n = 5). D) In the cliff avoidance reflex test, a main effect of the PA was noted (P = 0.017); pups exposed to both PA and AB (n = 9) showed the highest latency in turning away from the cliff compared to control (n = 10). E) For the limbs grasping reflex, a main effect of PA was found (P = 0.001); both the C-PA (n = 8) and the AB-PA (n = 11) groups exhibited a notably lower average of successful limb grasps compared to other groups (C-N: n = 10, AB-N: n = 7). Results are expressed as means ± s.e.m., *P < 0.05, **P = 0.01–0.05, ***P = 0.01–0.001, ****P < 0.001. PA, perinatal asphyxia.
Citation: Reproduction and Fertility 5, 4; 10.1530/RAF-24-0050
The grip strength response: a significant main effect of AB was noted (P < 0001). Offspring from the AB-N group demonstrated the weakest paw strength, followed by the AB-PA group, in contrast to the C-N group (AB-N: 49.330 ± 4.811°, n = 10, AB-PA: 68.123 ± 4.278°, n = 8 vs. C-N: 95.264 ± 2.062°, n = 5, P < 0.05) (Fig. 8C).
The cliff avoidance reflex test: PA exhibited a significant main effect (P = 0.017). Pups exposed to both PA and AB displayed the highest latency in turning away from the cliff when compared to the C-N group (AB-PA: 7.460 ± 0.996 sec, n = 9 vs. C-N: 3.507 ± 0.674 sec, n = 10, P < 0.05) (Fig. 8D).
The limbs grasping reflex test: PA again exhibited a significant main effect (P = 0.001). Both the C-PA and AB-PA groups demonstrated a significantly lower average of successful limb grasps compared to the control groups (C-PA: 2.250 ± 0.313 limbs, n = 8, AB-PA: 2.273 ± 0.574 limbs, n = 11 vs C-N: 4 ± 0 limbs, n = 10, AB-N:3.429 ± 0.297 limbs, n = 7, P < 0.05) (Fig. 8E).
Experiment 2 (GAA-2)
The righting reflex test: prenatal antibiotics displayed a significant main effect (P = 0.0003). Offspring exposed to AB ± PA displayed a significantly prolonged duration to achieve upright posture compared to the C-N group (AB-N: 2.861 ± 0.358 sec, n = 14, AB-PA: 2.984 ± 0.503 sec, n = 10 vs C-N: 1.476 ± 0.119 sec, n = 26, P < 0.05) (Fig. 9A).
The impact of gestational antibiotic administration (GAA-2) on the offspring neurodevelopmental reflexes in experiment 2. A) In the righting reflex test, AB exposure displayed a significant main effect (P = 0.0003); offspring exposed to AB ± PA (AB-N: n = 14, AB-PA: n = 10) presented with a longer time to flip onto their feet compared to the C-N group (n = 26). B) In the negative geotactic reaction, both AB and PA exhibited a significant main effect with P = 0.040, and P = 0.042, respectively; offspring exposed to both AB and PA (n = 8) presented with a longer time to turn up the slope compared to the C-N group (n = 10). C) In the grip strength response, no differences between the groups were noted. Results are expressed as means ± SEM, *P < 0.05, **P = 0.01–0.05. PA, perinatal asphyxia.
Citation: Reproduction and Fertility 5, 4; 10.1530/RAF-24-0050
The negative geotactic reaction test: both AB and PA exposure resulted in significant main effects with P = 0.040, and P = 0.042, respectively. Offspring exposed to AB and PA demonstrated an extended duration to navigate up the slope compared to the C-N group (AB-PA: 50.819 ± 18.814 sec, n = 8 vs C-N: 9.094 ± 1.792 sec, n = 10, P < 0.05) (Fig. 9B). The grip strength response: There was no significant variability across the experimental groups (P > 0.05) (Fig. 9C).
Antibiotic use during pregnancy (GAA-1) alongside perinatal asphyxia results in increased levels of inflammation and injury in offspring hippocampal tissue homogenate
Hippocampal levels of TNF-α and S-100B proteins were assessed 24 h post-asphyxia. In experiment 1, GAA-1 did not induce significant variability between groups in the assessment of S-100B protein levels (P > 0.05) (Fig. 10A). However, for TNF-α levels, PA resulted in a significant main effect (P = 0.010). Specifically, the AB-PA group exhibited the highest levels of TNF-α obtained from hippocampal tissue homogenate when compared to the C-N group (7.978 ± 1.036 pg/μg, n = 7 vs 3.925 ± 0.787 pg/μg, n = 5, P = 0.031) (Fig. 10B).
Hippocampal levels of TNF-α and S-100B proteins were assessed 24 h post-asphyxia. Experiment 1: A) GAA-1 didn’t manage to induce significant variability between groups when assessing S- 100B protein levels (P > 0.05); B) For the TNF-α levels, PA resulted in a significant main effect (P = 0.010); The AB-PA (n = 7) group exhibited the highest levels of TNF-α obtained from hippocampal tissue homogenate when compared to the C-N (n = 5) group (P = 0.031). Results are expressed as means ± SEM, *P < 0.05. GAA, gestational antibiotic administration.
Citation: Reproduction and Fertility 5, 4; 10.1530/RAF-24-0050
In experiment 2 (preliminary data, supplementary data, see section on supplementary materials given at the end of this article), for S-100B protein, AB administration induced a significant main effect (P = 0.026). Notably, the AB-N group presented the highest level of S-100B protein levels when compared to the C-N and C-PA groups, although with a limited number of samples (AB-N: 0.269 ± 0.139 pg/μg, n = 2 vs C-N: 0.012 ± 0.004 pg/μg, n = 3, P = 0.048, C-PA: 0.014 ± 0.007 pg/μg, n = 4, P = 0.040). Regarding TNF-α levels, AB administration resulted in a significant main effect (P = 0.028), although no direct variability between each group was observed (P > 0.05), considering the limited number of samples.
Discussion
Maternal antibiotic usage during pregnancy has become increasingly prevalent, serving as a crucial intervention for combating various infections (Broe et al. 2014). However, amidst its widespread use, concerns have arisen regarding the potential consequences on pediatric health. This concern is compounded by the escalating global threat of antibiotic resistance, which necessitates a comprehensive understanding of the collateral effects of antibiotic exposure (Galoș et al. 2023, Prajescu et al. 2023). Epidemiological investigations have unveiled alarming associations between early-life antibiotic exposure and heightened susceptibility to immune and metabolic disorders, underscoring the intricate interplay between antibiotic administration and the delicate developmental trajectories of offspring (Lamont et al. 2020). Of particular concern are the neurodevelopmental repercussions linked to maternal antibiotic exposure during pregnancy. Studies have elucidated a troubling correlation between prenatal antibiotic therapy and increased incidences of neurodevelopmental disorders, including attention deficit hyperactivity disorder (ADHD) and epilepsy, underscoring the multifaceted impact of antibiotics on fetal brain development (Tao et al. 2022, Straughen et al. 2023).
Therefore, considering the known impact of antibiotics on the gut microbiome (Patangia et al. 2022), it is plausible to hypothesize that any observed effects on neurodevelopment could be mediated, at least in part, by alterations in the microbial composition of the gut. This assertion is particularly relevant given that antibiotic administration is commonly utilized as a means to induce microbiome depletion, serving as a valuable model for exploring the role of the gut microbiome across diverse physiological contexts (Zarrinpar et al. 2014).
In neonatal rodents, maternal antibiotic exposure changes the bacterial communities of the gut microbiota and causes intestinal damage and inflammation by reducing vascularization and cellular proliferation, and impairing the intestinal barrier (Chen et al. 2021). Regarding neurodevelopment, the expression of genes related to axonogenesis, synaptic plasticity, and behavior is impaired in rodents from antibiotic-treated dams (Desbonnet et al. 2015, Vuong et al. 2020, O’Connor et al. 2021). Moreover, antibiotic administration to dams results in behavior deficits in the offspring but with conflicting outcomes regarding activity, social interactions, and anxiety (Degroote et al. 2016, Tochitani et al. 2016, Leclercq et al. 2017, O’Connor et al. 2021). Furthermore, antibiotic-mediated changes in the gut microbiota can induce a decrease in the level of hypothalamic neuropeptides such as oxytocin (Desbonnet et al. 2015), a neurohormone with a fundamental role in maternal behavior (Zagrean et al. 2022).
PA, characterized by inadequate blood flow or gas exchange, is linked to elevated mortality and morbidity rates among children (Lawn et al. 2011). The therapeutic options for PA and subsequent HIE remain notably restricted, and translating findings from animal studies to clinical settings has proven exceptionally challenging. Despite notable progress in medical advancements, hypothermia remains the primary neuroprotective intervention for term neonates with HIE following PA, as it is the sole therapy supported by substantial clinical evidence demonstrating neuroprotective benefits (Antonucci et al. 2014). However, the available data on the effectiveness of hypothermia in reducing mortality and ameliorating neurodevelopmental disabilities among infants affected by PA remains limited (McGuire 2007).
Therefore, it becomes imperative to explore maternal factors that may exert an influence on the outcome of PA in offspring. We have previously investigated several maternal factors that can modulate the severity and impact of PA and found that diet-related factors, such as a high-fat diet (Isac et al. 2018) increase vulnerability in the neonate, while other nutrients, such as trans-resveratrol and citicoline, supplemented into the maternal diet provide neuroprotection for the PA exposed offspring (Isac et al. 2017, Isac et al. 2020). Since diet is the pivotal sculptor of the diversity and composition of the gut microbiota (Ionescu et al. 2024), we postulate that the maternal gut microbiome plays a crucial role in determining the outcome of offspring subjected to PA. Thus, it is necessary to develop a model that comprehensively integrates the multifaceted influences of maternal microbial alterations induced by antibiotic administration and subsequent neurodevelopmental outcomes in offspring following PA.
The adverse effects of the first antibiotic cocktail necessitated refinement of the antibiotic formulation
Our initial experimental findings have provided valuable insights into the specific risks associated with certain antibiotic cocktails, highlighting the need for targeted refinement to mitigate potential harm. The administration of our first antimicrobial cocktail (GAA-1) resulted in poor weight gain during pregnancy, elevated rates of miscarriages, reaching 50%, and reduced offspring weight, prompting a reassessment of the constituents of the cocktail.
It’s noteworthy that we strictly adhered to the ethical standards of the animal facility, ensuring the experiment proceeded as the dams’ weight loss during pregnancy was not more than 20% of the baseline. Additionally, we observed a decline in glucose levels in these animals, likely attributed to reduced intake of water and subsequent food consumption. Although our antimicrobial cocktail composition was based on previous studies that deemed it safe, literature evidence has encountered similar challenges to ours. For instance, a study investigating the effects of antibiotic-induced microbiome depletion on intestinal health utilized a similar antimicrobial cocktail (with metronidazole instead of clindamycin) in drinking water. They observed rodents experiencing weight loss and reduced water intake, leading to the need for a switch to gavage administration (Reikvam et al. 2011). Subsequent modifications aimed to optimize pregnancy safety by excluding compounds known for adverse outcomes, such as amphotericin-B and its solvent DMSO, and substituting potentially safer alternatives for antibiotics like clindamycin.
Amphotericin-B can increase the stillbirth rates in rodent and rabbit models, as documented in previous studies (Larson et al. 2000). In rabbits, administration of amphotericin-B led to a higher incidence of spontaneous abortions (King et al. 1998). Furthermore, research employing a chick embryo model revealed that amphotericin-B impacted angiogenesis, upregulated the expression of apoptosis-related genes, and induced histopathological changes characterized by degenerative and apoptotic-necrotic alterations (Khosravi et al. 2022). Given the short-term nature of our antibiotic regimen and lack of fungal overgrowth concerns, we opted to exclude amphotericin-B from our protocol.
Administration of DMSO to pregnant mice resulted in reduced birth weight and decreased serum glucose in males, with females showing decreased hippocampal brain-derived neurotrophic factor expression (Chen et al. 2023). DMSO also heightened oxidative stress, inducing apoptosis in mouse embryonic fibroblasts (Wuputra et al. 2022). It interfered with early embryonic development in a concentration-dependent manner, potentially arresting development at various stages due to oxidative stress, leading to mitophagy and autophagy. Additionally, DMSO reduced blastocyst quality, impaired implantation capabilities, and increased pregnancy loss (Kang et al. 2017) which might explain the high number of stillborn pregnancies recorded during experiment 1. Given these adverse effects and the exclusion of amphotericin-B, DMSO use was deemed unnecessary.
Clindamycin, categorized as FDA pregnancy category B, is generally considered safe for use during pregnancy, although it can cross the placental barrier (Brigg’s Drugs in Pregnancy and Lactation). While animal studies have not shown teratogenic effects (Bollert et al. 1974), potential adverse effects on fetal development in humans have been suggested. A Canadian population-based cohort study reported a small increased risk of musculoskeletal malformations and defects in cardiac septum associated with clindamycin use during pregnancy (Muanda et al. 2017). Similarly, analysis of the EUROmediCAT database revealed a potential association between clindamycin exposure during pregnancy and hydrocephalus (Leke et al. 2021). In a zebrafish model, lincomycin, the parent compound of clindamycin, exhibited neurotoxic effects, including brain deformities and altered neurodevelopmental genes, along with increased acetylcholine esterase activity and oxidative stress (Cheng et al. 2020). Given clindamycin’s significant oral bioavailability and its capacity to cross the placental barrier, potentially posing detrimental effects on fetal development, we decided to replace this antibiotic within our formulation.
Notably, the quest for pregnancy-safe antibiotics has led to the identification of oral vancomycin, neomycin, and meropenem as viable options due to their limited systemic absorption and minimized fetal exposure (Fröhlich et al. 2016, de Bruijn et al. 2020, Raza et al. 2021). Additionally, ampicillin has been extensively studied in pregnant women and has not been associated with an increased risk of adverse pregnancy outcomes or birth defects (Bookstaver et al. 2015).
Following the utilization of the optimized cocktail, the weight gain during pregnancy was appropriate, with glucose levels comparable to the control group, with no miscarriage occurrences, and with substantial litters with no discernible variations in offspring weights. Therefore, for the subsequent experiments, we opted to employ the second antibiotic cocktail, which was refined based on the observations from the initial trials. The second cocktail was meticulously formulated to strike a balance between achieving microbiome modulation and minimizing potential maternal and offspring health risks.
Antibiotic administration during pregnancy induced alterations in the maternal gut microbiome
Although the number of samples was limited, efforts were made to assess the influence of the administered antibiotic cocktails on the composition of the maternal gut microbiome in both experiments. In both experiments, the antibiotic-exposed group showed a slight, non-significant reduction in Butyricicoccus species compared to the control. Butyricicoccus ferments undigested fibers into butyrate, a short-chain fatty acid (SCFA) with anti-inflammatory and immunomodulatory effects (Xi et al. 2021, Singh et al. 2023). Reduced Butyricicoccus levels are linked to neurological and psychiatric disorders, including Postpartum Depressive Disorder (Zhou et al. 2020) and ADHD (Wang et al. 2023). Butyrate is crucial for neurodevelopment, as low-fiber diets in rodent models lead to reduced butyrate, impaired motor skills, anxiety, and cognitive deficits, while maternal butyrate supplementation improves cognitive function and neuroplasticity (Hernández-Martínez et al. 2022). Butyrate's effects on neural proliferation are dose-dependent, with physiological levels being beneficial and high levels causing neurotoxicity (Yoo et al. 2011, Yang et al. 2020).
Bacteria from the Faecalibacterium genus are among the main butyrate-producing microorganisms in the gut (Faden 2022). A lower level of Faecalibacterium was found in psychiatric diseases such as major depressive disorder (Jiang et al. 2015), ADHD (Wan et al. 2020), and autism spectrum disorder (ASD) (Angelis et al. 2013). However, studies also identified an augmented proportion of this genus in ASD (Iglesias-Vázquez et al. 2020) and epilepsy (Cui et al. 2022), highlighting its complex contribution to human pathology. In experiment 2, the antibiotic cocktail decreased the Faecalibacterium level, in accordance with a dysbiotic, pro-inflammatory state. Intriguingly, in experiment 1, bacteria from the genus Faecalibacterium displayed a significantly higher abundance. However, there is evidence that certain antibiotics can increase the proportion of this genus. For example, antibiotic administration (mainly cephalosporins and erythromycin) during the first year of life was associated with a higher percentage of Faecalibacterium (Li et al. 2022), and nitrofurantoin had the same effect in patients suffering from urinary tract infections (Stewardson et al. 2015). Moreover, the results could be explained by the considerable variability in the behavior of different species, since intestinal inflammation was associated with an increased abundance of Faecalibacterium longum L2-6, but a decreased level of Faecalibacterium duncaniae A2-165 (Martín et al. 2023).
Regarding Bacteroides species, our findings yielded conflicting trends between the two experiments, albeit lacking statistical significance. Despite the discordant nature of these findings, they are congruent with existing literature. A rodent study employing ampicillin to induce gestational dysbiosis revealed that male offspring exhibited modified patterns in ultrasonic communication and later reduced social behavior. Examination of the gut microbiota composition indicated an elevation in Bacteroides, among other genera (Morel et al. 2023). On the other hand, the administration of Bacteroides fragilis as a probiotic in a murine model displaying characteristics of ASD improved the behavior and gut permeability (Hsiao et al. 2013). Furthermore, a cohort study of 405 infants found a positive correlation between Bacteroides-dominant microbiota and better results for cognitive, language, and motor development at the age of two (Tamana et al. 2021 Jan 1). Interestingly, another study associated an increase in the abundance of Bacteroides with fetal growth restriction (Tu et al. 2022). These taken together paint a cloudy picture of the specific importance of Bacteroides regarding the offspring’s neurodevelopment.
In both experiments, Fusobacterium exhibited elevated levels in the antibiotic-exposed group compared to the control group. Fusobacterium recognized as an opportunistic pathogen (Umana et al. 2019) was related to adverse pregnancy outcomes and inflammatory bowel disease (Fan et al. 2023). Moreover, members of the Fusobacterium genus can provoke inflammation by activating pathways such as p-ERK, p-CREB, and NF-κB, particularly in gut microbiota antibiotic depletion scenarios (Engevik et al. 2021).
Antibiotic exposure resulted in a marginal reduction of Lactobacillus and Bifidobacterium levels across both experimental conditions. These bacteria represent some of the most used strains as probiotics. Although they have been shown to reduce cytokine levels, the mechanism remains unclear (Wang et al. 2015, Kar et al. 2022). The administration of these species to pregnant female rats effectively mitigated the neuroinflammation levels induced by lipopolysaccharides (LPS) (Kar et al. 2022). Aside from the inflammatory signaling-reducing properties, the SCFAs produced by Bifidobacterium and Lactobacillus promote the development of microglia, increase neurogenesis, and strengthen the blood-brain barrier (Spichak et al. 2021). The beneficial role of Bifidobacterium has been highlighted in multiple studies, being associated with decreased anxiety, stress, depression, and better learning in mice (Savignac et al. 2015). That being said, the slightly decreased levels of Bifidobacterium and Lactobacillus could negatively impact the central nervous system, leading to the impaired neurodevelopmental parameters of the antibiotic cohort.
In experiment 1, exposure to antibiotics resulted in a significant elevation in the levels of Enterobacteriaceae, a family of gram-negative bacteria known to produce LPS. The presence of LPS typically triggers the activation of proinflammatory mediators, such as TNF (Jang et al. 2018). Escherichia coli treatment in mice increases NF-κB activation and TNF-α expression in the hippocampus, which could impact spatial memory and memory consolidation. Additionally, Escherichia coli suppresses the expression of tight junction proteins, boosting the absorption of additionally administered LPS, and sustaining its effects (Jang et al. 2018). A high abundance of Escherichia coli has also been associated with increased hypoxia-ischemia-induced brain injury (Drobyshevsky et al. 2024).
A systematic review showed that clindamycin can reduce the abundance of Lactobacillus, Fusobacterium, Bacteroides, and Bifidobacteria, with similar effects seen for meropenem (Zimmermann & Curtis 2019). Data on ampicillin's impact were limited, but amoxicillin, a related antibiotic, increased levels of Enterobacteriaceae, Lactobacillus, Bacteroides, and Bifidobacteria. However, amoxicillin increased Lactobacillus abundance, while ampicillin reduced it. Another study found that ampicillin or vancomycin increased Bacteroides and decreased Lactobacillus in mice (Huang et al. 2022). Conversely, a combination of these antibiotics with neomycin and metronidazole decreased Bacteroides. These findings highlight the complex interactions within the gut microbiota and suggest that antibiotic mixtures can lead to unexpected changes in bacterial abundance.
PA impaired neurodevelopmental reflexes: a phenomenon exacerbated by maternal antibiotic supplementation
Neurodevelopmental reflex testing serves as a valuable tool in clinical practice to assess nervous system maturation, with aberrant developmental reflexes often indicative of conditions such as cerebral palsy, which may manifest following PA (Nguyen et al. 2017). This approach enables the early detection of brain injury and allows for the evaluation of maternal microbiome interventions, which would otherwise be challenging in such young animals.
Each of these neurodevelopmental reflexes assesses different parts of innate behavior. The RR tests the motor ability of the rodent to flip onto its feet from a supine position, testing the vestibular system, and prolonged or loss of righting reflex is associated with impaired neurodevelopment (Panaitescu et al. 2018). The NGR is employed to evaluate motor coordination by investigating the automatic vestibular response to geogravitational stimuli. This reflex represents an innate reaction characterized by directional movement against gravitational cues, providing insights into sensory or proprioceptive function. Serving as an initial assessment tool, the NGR aids in the evaluation of motor development, reflexes, activity patterns, and vestibular function (Alberts et al. 2004, Ruhela et al. 2019). In the GSR, the strength of all four paws is tested. Regarding climbing and sprinting across irregular terrains, a rodent's proficiency in utilizing all four paws for grasping holds significant importance (Feather-Schussler & Ferguson 2016). The CAR is useful for measuring vestibular imbalances and evaluates the labyrinth reflexes, strength, and coordination (Feather-Schussler & Ferguson 2016). A reduced or negative LGR during early life can suggest later development of spasticity, thus indicating damage to the nervous system (Futagi et al. 2012).
In both experimental setups, maternal antibiotic administration and PA elicited detrimental effects on early neurodevelopmental parameters. Dysbiosis induced by prenatal interventions was associated with impaired neurodevelopmental reflexes in preclinical studies, and these impairments were reduced by restoring the homeostasis of the gut microbiota (Yuan et al. 2022, Chen et al. 2024). However, the observed changes in experiment 1 may not solely be attributed to the impact of antibiotics on the intestinal microbiome. Additionally, the potential teratogenic effects of the antimicrobial cocktail components, particularly GAA-1, should be considered.
PA increased hippocampal inflammation and injury, augmented by antibiotic administration during pregnancy
We previously noted S-100B protein and TNF-α to be indicative biomarkers for evaluating hippocampal damage associated with PA (Isac et al. 2017). In experiment 1, neither antibiotic exposure nor PA elicited significant changes, possibly due to the limited sample size or the short 24-h recovery period post-asphyxia. However, TNF-α levels were notably elevated in the PA group, with antibiotics exacerbating this effect. In experiment 2, antibiotic exposure yielded a significant main effect on both S-100B and TNF-α levels, under the reserve of a limited number of samples (supplementary data).
S-100B is a calcium-binding protein localized in a multitude of cells comprising the nervous system, concentrated mainly in the glial cells (Michetti et al. 2012). Elevated S-100B levels serve as an indicator for predicting early brain damage in neonates affected by PA (Luo et al. 2019) and here we note the levels to be exacerbated by the antibiotic cocktail in experiment 2.
TNF-α stands as a pivotal pro-inflammatory cytokine in pathological contexts, predominantly released by astrocytes and microglia. This de novo synthesis of TNF-α represents a significant facet of the neuroinflammatory response linked with various neurological disorders (Olmos and Lladó 2014). We noted elevated TNF-α levels in the PA groups, with the effect further potentiated by maternal antibiotic exposure. These findings underscore the profound influence of maternal antibiotic administration on offspring brain function, exacerbating neuroinflammation following PA.
To summarize, differences have emerged between the groups subjected to gestational antibiotics and those exposed to PA across both experiments. It is imperative to consider that in experiment 1, certain effects attributed to antibiotics may stem from their teratogenic properties rather than solely from microbiome-mediated influences. Consequently, our findings summarized in Fig. 11 suggest that the second antibiotic cocktail represents the most prudent selection for investigating the impact of maternal dysbiosis on offspring subjected to PA.
The Link between maternal gut dysbiosis and offspring neurodevelopmental alterations and increased brain vulnerability. This figure illustrates how gestational antibiotic-induced disruption of the maternal gut microbiome leads to dysbiosis. These changes can trigger systemic inflammation and influence fetal brain development. This heightened vulnerability is further exacerbated when the offspring is subjected to PA, resulting in impaired neurodevelopmental outcomes and increased neuroinflammation in the hippocampus.
Citation: Reproduction and Fertility 5, 4; 10.1530/RAF-24-0050
Future perspectives
In our ongoing exploration of the microbiota’s impact on the neural development of rat offspring, we plan to enhance our understanding by integrating probiotics alongside the revised antibiotic cocktail. Supplementation with probiotics has shown promise in partially restoring altered microbiota and alleviating some of its effects on the brain (Leclercq et al. 2017). Therefore, investigating the potential beneficial effects of probiotic administration following maternal antibiotic treatment aims to elucidate mechanisms underlying probiotic action and their potential to mitigate trans-generational gut-brain axis dysfunction.
In addition to assessing the immediate neurodevelopmental outcomes in offspring, long-term consequences of maternal gut microbiome alterations on both maternal and offspring behavior in the context of PA should be considered. By conducting extended follow-up assessments, the enduring impacts of maternal dysbiosis and antibiotic exposure during pregnancy on various aspects of behavior, including social interactions, cognitive functions, and emotional regulation, particularly in offspring exposed to PA can be revealed. This longitudinal approach can provide valuable insights into the persistence and evolution of neurobehavioral alterations over time, shedding light on the potential trajectories of neurodevelopmental disorders arising from maternal microbiome disruptions exacerbated by PA. Moreover, by examining maternal behavior alongside offspring outcomes, we can uncover the reciprocal influences between maternal gut microbiota composition, PA, and caregiving behaviors, which may further shape offspring neurodevelopmental trajectories.
Study limitations
It’s important to acknowledge several limitations in our study. First, our sample size may be limited, potentially impacting the generalizability of our findings, especially regarding the microbiome study. Additionally, while rodent models offer valuable insights, they may not fully replicate human physiology and behavior. The duration of our study may also be limited, restricting our ability to assess long-term effects on offspring neurodevelopment. Furthermore, our focus on maternal antibiotic exposure may overlook the potential influence of other maternal factors and environmental variables.
Conclusion
This study establishes a novel experimental model to investigate the impact of maternal dysbiosis triggered by GAA and combined with PA on offspring neurodevelopment. Maternal gut microbiome disruption induced by GAA-1 resulted in increased miscarriages, poor weight gain during pregnancy, and reduced offspring weight, but refinement of the antibiotic cocktail minimized pregnancy risks. PA further exacerbated neurodevelopmental impairments, augmented by antibiotic exposure. The observed behavioral deficits underscore the significance of maternal factors, particularly gut microbiome integrity, in influencing offspring neurodevelopmental outcomes. These findings emphasize caution in gestational antimicrobial use with subsequent microbiome-associated impairments and warrant further exploration of interventions to mitigate neurodevelopmental sequelae. Future research integrating probiotics alongside antibiotics aims to elucidate protective mechanisms against perinatal brain injury and gut microbiome alterations, contributing to targeted interventions for safeguarding neonatal brain health.
Supplementary materials
This is linked to the online version of the paper at https://doi.org/10.1530/RAF-24-0050.
Declaration of interest
The authors declare that there is no conflict of interest that could be perceived as prejudicing the impartiality of the study reported.
Funding
This study was funded by Carol Davila Young Investigator Research Grant 1298/31.05.2021 awarded to M.I.I. and by the Sectoral Research and Development Program of the Romanian Ministry of National Defense (PSCD NEURO_Depress 25/2023-2025).
Author contribution statement
MII, IAD, DB, and C.C. wrote the manuscript. MII, AMC, and GGP performed the data analysis. MII, AMC, CH, VS, and GGP performed the animal behaviour tests and sample processing. SOM and AMZ reviewed the manuscript and supervised the project.
Acknowledgements
The authors would like to thank to Scientific Researchers Popescu Diana Mihaela PhD, Diana Maria Chitimus MD, PhD student, and Vlad Morozan MD, PhD student for their outstanding technical assistance throughout the study.
References
Adediran SA, Day TP, Sil D, Kimbrell MR, Warshakoon HJ, Malladi SS & & David SA 2009 Synthesis of a highly water-soluble derivative of amphotericin B with attenuated proinflammatory activity. Molecular Pharmaceutics 6 1582–1590. (https://doi.org/10.1021/mp9001602)
Alberts JR, Motz BA & & Schank JC 2004 Positive geotaxis in infant rats (Rattus norvegicus): a natural behavior and a historical correction. Journal of Comparative Psychology 118 123–132. (https://doi.org/10.1037/0735-7036.118.2.123)
Angelis MD, Piccolo M, Vannini L, Siragusa S, De Giacomo A, Serrazzanetti DI, Cristofori F, Guerzoni ME, Gobbetti M & & Francavilla R 2013 Fecal microbiota and metabolome of children with autism and pervasive developmental disorder not otherwise specified. PLoS One 8 e76993. (https://doi.org/10.1371/journal.pone.0076993)
Antonucci R, Porcella A & & Pilloni MD 2014 Perinatal asphyxia in the term newborn. Journal of Pediatric and Neonatal Individualized Medicine (JPNIM) 3 e030269. (https://doi.org/10.7363/030269)
Batzias GC, Delis GA & & Athanasiou LV 2005 Clindamycin bioavailability and pharmacokinetics following oral administration of clindamycin hydrochloride capsules in dogs. Veterinary Journal 170 339–345. (https://doi.org/10.1016/j.tvjl.2004.06.007)
Bollert JA, Gray JE, Highstrete JD, Moran J, Purmalis BP & & Weaver RN 1974 Teratogenicity and neonatal toxicity of clindamycin 2-phosphate in laboratory animals. Toxicology and Applied Pharmacology 27 322–329. (https://doi.org/10.1016/0041-008X(7490203-8)
Bongers KS, McDonald RA, Winner KM, Falkowski NR, Brown CA, Baker JM, Hinkle KJ, Fergle DJ & & Dickson RP 2022 Antibiotics cause metabolic changes in mice primarily through microbiome modulation rather than behavioral changes. PLoS One 17 e0265023. (https://doi.org/10.1371/journal.pone.0265023)
Bookstaver PB, Bland CM, Griffin B, Stover KR, Eiland LS & & McLaughlin M 2015 A review of antibiotic use in pregnancy. Pharmacotherapy 35 1052–1062. (https://doi.org/10.1002/phar.1649)
Briggs GG, Freeman RK & Tower CV et al. 2021 Brigg’s drugs in pregnancy and lactation: a reference guide to fetal and neonatal. Risk. Available at: https://www.wolterskluwer.com/en/solutions/ovid/briggs-drugs-in-pregnancy-and-lactation-a-reference-guide-to-fetal-and-neonatal-risk-730. Accessed May 9, 2024.
Broe A, Pottegård A, Lamont RF, Jørgensen JS & & Damkier P 2014 Increasing use of antibiotics in pregnancy during the period 2000–2010: prevalence, timing, category, and demographics. BJOG 121 988–996. (https://doi.org/10.1111/1471-0528.12806)
Chen C-M, Chou H-C & & Yang Y-CSH 2021 Maternal antibiotic treatment disrupts the intestinal microbiota and intestinal development in neonatal mice. Frontiers in Microbiology 12. (https://doi.org/10.3389/fmicb.2021.684233)
Chen F, Zhang L, Liu Y, Zhang A & & Wang W 2024 Resveratrol alleviates perinatal methylmercury-induced neurobehavioral impairments by modulating the gut microbiota composition and neurotransmitter disturbances. Environmental Toxicology 39 329–340. (https://doi.org/10.1002/tox.23973)
Chen K, Lu X, Xu D, Guo Y, Ao Y & & Wang H 2023 Prenatal exposure to corn oil, CMC-Na or DMSO affects physical development and multi-organ functions in fetal mice. Reproductive Toxicology 118 108366. (https://doi.org/10.1016/j.reprotox.2023.108366)
Cheng B, Jiang F, Su M, Zhou L, Zhang H, Cao Z, Liao X, Xiong G, Xiao J, Liu F, et al.2020 Effects of lincomycin hydrochloride on the neurotoxicity of zebrafish. Ecotoxicology and Environmental Safety 201 110725. (https://doi.org/10.1016/j.ecoenv.2020.110725)
Cheng H, Han Y, Zhang J, Zhang S, Zhai Y, An X, Li Q, Duan J, Zhang X, Li Z, et al.2022 Effects of dimethyl sulfoxide (DMSO) on DNA methylation and histone modification in parthenogenetically activated porcine embryos. Reproduction, Fertility, and Development 34 598–607. (https://doi.org/10.1071/RD21083)
Codagnone MG, Spichak S, O’Mahony SM, O’Leary OF, Clarke G, Stanton C, Dinan TG & & Cryan JF 2019 Programming bugs: microbiota and the developmental origins of brain health and disease. Biological Psychiatry 85 150–163. (https://doi.org/10.1016/j.biopsych.2018.06.014)
Cui G, Liu S, Liu Z, Chen Y, Wu T, Lou J, Wang H, Zou Y, Sun Y, Rao B, et al.2022 Gut microbiome distinguishes patients with epilepsy from healthy individuals. Frontiers in Microbiology 12. (https://doi.org/10.3389/fmicb.2021.696632)
de Bruijn V, Behr C, Sperber S, Walk T, Ternes P, Slopianka M, Haake V, Beekmann K & & van Ravenzwaay B 2020 Antibiotic-induced changes in microbiome-related metabolites and bile acids in rat plasma. Metabolites 10 242. (https://doi.org/10.3390/metabo10060242)
Degroote S, Hunting DJ, Baccarelli AA & & Takser L 2016 Maternal gut and fetal brain connection: increased anxiety and reduced social interactions in Wistar rat offspring following peri-conceptional antibiotic exposure. Progress in Neuro-Psychopharmacology and Biological Psychiatry 71 76–82. (https://doi.org/10.1016/j.pnpbp.2016.06.010)
Deng H, Yu Y, Sha Q, Sun W, Liang L, Ren F, Ji H, Shen X & & Fan X 2023 Construction of antibiotic-induced depression mice model and the function of intestinal microbiota. Frontiers in Microbiology 14 1093486. (https://doi.org/10.3389/fmicb.2023.1093486)
Desbonnet L, Clarke G, Traplin A, O’Sullivan O, Crispie F, Moloney RD, Cotter PD, Dinan TG & & Cryan JF 2015 Gut microbiota depletion from early adolescence in mice: implications for brain and behaviour. Brain, Behavior, and Immunity 48 165–173. (https://doi.org/10.1016/j.bbi.2015.04.004)
Drobyshevsky A, Synowiec S, Goussakov I, Fabres R, Lu J & & Caplan M 2024 Intestinal microbiota modulates neuroinflammatory response and brain injury after neonatal hypoxia-ischemia. Gut Microbes 16 2333808. (https://doi.org/10.1080/19490976.2024.2333808)
Dudek-Wicher RK, Junka A & & Bartoszewicz M 2018 The influence of antibiotics and dietary components on gut microbiota. Przegląd Gastroenterologiczny 13 85–92. (https://doi.org/10.5114/pg.2018.76005)
Engevik MA, Danhof HA, Ruan W, Engevik AC, Chang-Graham AL, Engevik KA, Shi Z, Zhao Y, Brand CK, Krystofiak ES, et al.2021 Fusobacterium nucleatum secretes outer membrane vesicles and promotes intestinal inflammation. mBio 12. (https://doi.org/10.1128/mBio.02706-20).
Faas MM, Liu Y, Wekema L, Weiss GA, van Loo-Bouwman CA & & Silva Lagos L 2023 The effect of antibiotics treatment on the maternal immune response and gut microbiome in pregnant and non-pregnant mice. Nutrients 15 2723. (https://doi.org/10.3390/nu15122723)
Faden H 2022 The role of Faecalibacterium, Roseburia, and butyrate in inflammatory bowel disease. Digestive Diseases 40 793–795. (https://doi.org/10.1159/000522247)
Fan Z, Tang P, Li C, Yang Q, Xu Y, Su C & & Li L 2023 Fusobacterium nucleatum and its associated systemic diseases: epidemiologic studies and possible mechanisms. Journal of Oral Microbiology 15 2145729. (https://doi.org/10.1080/20002297.2022.2145729)
Feather-Schussler DN & & Ferguson TS 2016 A battery of motor tests in a neonatal mouse model of cerebral palsy. Journal of Visualized Experiments: JoVE (117) 53569. (https://doi.org/10.3791/53569)
Fröhlich EE, Farzi A, Mayerhofer R, Reichmann F, Jačan A, Wagner B, Zinser E, Bordag N, Magnes C, Fröhlich E, et al.2016 Cognitive impairment by antibiotic-induced gut dysbiosis: analysis of gut microbiota-brain communication. Brain, Behavior, and Immunity 56 140–155. (https://doi.org/10.1016/j.bbi.2016.02.020)
Futagi Y, Toribe Y & & Suzuki Y 2012 The grasp reflex and Moro reflex in infants: hierarchy of primitive reflex responses. International Journal of Pediatrics 2012 191562. (https://doi.org/10.1155/2012/191562)
Galoș F, Boboc C, Ieșanu M-I, Anghel M, Ioan A, Iana E, Coșoreanu MT & & Boboc AA 2023 Antibiotic resistance and therapeutic efficacy of Helicobacter pylori infection in pediatric patients—A tertiary center experience. Antibiotics 12 146. (https://doi.org/10.3390/antibiotics12010146)
Gillam-Krakauer M, Shah M & & Gowen CW Jr 2024 Birth asphyxia. In StatPearls. Treasure Island (FL): StatPearls Publishing. Available at: (http://www.ncbi.nlm.nih.gov/books/NBK430782/).
Golubeva AV, Crampton S, Desbonnet L, Edge D, O’Sullivan O, Lomasney KW, Zhdanov AV, Crispie F, Moloney RD, Borre YE, et al.2015 Prenatal stress-induced alterations in major physiological systems correlate with gut microbiota composition in adulthood. Psychoneuroendocrinology 60 58–74. (https://doi.org/10.1016/j.psyneuen.2015.06.002)
Helmy MM, Ruusuvuori E, Watkins PV, Voipio J, Kanold PO & & Kaila K 2012 Acid extrusion via blood–brain barrier causes brain alkalosis and seizures after neonatal asphyxia. Brain 135 3311–3319. (https://doi.org/10.1093/brain/aws257)
Hernández-Martínez C, Canals J, Voltas N, Martín-Luján F & & Arija V 2022 Circulating levels of short-chain fatty acids during pregnancy and infant neurodevelopment. Nutrients 14 3946. (https://doi.org/10.3390/nu14193946)
Hoyberghs J, Bars C, Ayuso M, Van Ginneken C, Foubert K & & Van Cruchten S 2021 DMSO concentrations up to 1% are safe to be used in the zebrafish embryo developmental toxicity assay. Frontiers in Toxicology 3 804033. (https://doi.org/10.3389/ftox.2021.804033)
Hsiao EY, McBride SW, Hsien S, Sharon G, Hyde ER, McCue T, Codelli JA, Chow J, Reisman SE, Petrosino JF, et al.2013 Microbiota modulate behavioral and physiological abnormalities associated with neurodevelopmental disorders. Cell 155 1451–1463. (https://doi.org/10.1016/j.cell.2013.11.024)
Huang C, Feng S, Huo F & & Liu H 2022 Effects of four antibiotics on the diversity of the intestinal microbiota. Microbiology Spectrum 10 e0190421. (https://doi.org/10.1128/spectrum.01904-21)
Iglesias-Vázquez L, Van Ginkel Riba G, Arija V & & Canals J 2020 Composition of gut microbiota in children with autism spectrum disorder: a systematic review and meta-analysis. Nutrients 12 792. (https://doi.org/10.3390/nu12030792)
Ionescu MI, Zahiu CDM, Vlad A, Galos F, Gradisteanu Pircalabioru G, Zagrean A-M & & O’Mahony SM 2024 Nurturing development: how a mother’s nutrition shapes offspring’s brain through the gut. Nutritional Neuroscience 0 1–23. (https://doi.org/10.1080/1028415X.2024.2349336)
Isac S, Panaitescu AM, Iesanu M, Grigoras IF, Totan A, Udriste A, Cucu N, Peltecu G, Zagrean L & & Zagrean A-M 2018 Maternal high-fat diet modifies the immature hippocampus vulnerability to perinatal asphyxia in rats. Neonatology 114 355–361. (https://doi.org/10.1159/000491383)
Isac S, Panaitescu AM, Iesanu MI, Zeca V, Cucu N, Zagrean L, Peltecu G & & Zagrean A-M 2020 Maternal citicoline-supplemented diet improves the response of the immature hippocampus to perinatal asphyxia in rats. Neonatology 117 729–735. (https://doi.org/10.1159/000512145)
Isac S, Panaitescu AM, Spataru A, Iesanu M, Totan A, Udriste A, Cucu N, Peltecu G, Zagrean L & & Zagrean A-M 2017 Trans-resveratrol enriched maternal diet protects the immature hippocampus from perinatal asphyxia in rats. Neuroscience Letters 653 308–313. (https://doi.org/10.1016/j.neulet.2017.06.003)
Jang SE, Lim SM, Jeong JJ, Jang HM, Lee HJ, Han MJ & & Kim DH 2018 Gastrointestinal inflammation by gut microbiota disturbance induces memory impairment in mice. Mucosal Immunology 11 369–379. (https://doi.org/10.1038/mi.2017.49)
Jiang H, Ling Z, Zhang Y, Mao H, Ma Z, Yin Y, Wang W, Tang W, Tan Z, Shi J, et al.2015 Altered fecal microbiota composition in patients with major depressive disorder. Brain, Behavior, and Immunity 48 186–194. (https://doi.org/10.1016/j.bbi.2015.03.016)
Kang M-H, Das J, Gurunathan S, Park H-W, Song H, Park C & & Kim J-H 2017 The cytotoxic effects of dimethyl sulfoxide in mouse preimplantation embryos: a mechanistic study. Theranostics 7 4735–4752. (https://doi.org/10.7150/thno.21662)
Kar F, Hacioglu C, Kar E, Donmez DB & & Kanbak G 2022 Probiotics ameliorates LPS induced neuroinflammation injury on Aβ 1–42, APP, γ-β secretase and BDNF levels in maternal gut microbiota and fetal neurodevelopment processes. Metabolic Brain Disease 37 1387–1399. (https://doi.org/10.1007/s11011-022-00964-z)
Kennedy EA, King KY & & Baldridge MT 2018 Mouse microbiota models: comparing Germ-free mice and antibiotics treatment as tools for modifying gut bacteria. Frontiers in Physiology 9 1534. (https://doi.org/10.3389/fphys.2018.01534)
Kennedy KM, de Goffau MC, Perez-Muñoz ME, Arrieta M-C, Bäckhed F, Bork P, Braun T, Bushman FD, Dore J, de Vos WM, et al.2023 Questioning the fetal microbiome illustrates pitfalls of low-biomass microbial studies. Nature 613 639–649. (https://doi.org/10.1038/s41586-022-05546-8)
Khosravi A, Sharifi I, Tavakkoli H, Molaakbari E, Bahraminegad S, Salarkia E, Seyedi F, Keyhani A, Salari Z, Sharifi F, et al.2022 Cytotoxicity of amphotericin B and AmBisome: in silico and in vivo evaluation employing the chick embryo model. Frontiers in Pharmacology 13 860598. (https://doi.org/10.3389/fphar.2022.860598)
Kim S, Kim H, Yim YS, Ha S, Atarashi K, Tan TG, Longman RS, Honda K, Littman DR, Choi GB, et al.2017 Maternal gut bacteria promote neurodevelopmental abnormalities in mouse offspring. Nature 549 528–532. (https://doi.org/10.1038/nature23910)
King CT, Rogers PD, Cleary JD & & Chapman SW 1998 Antifungal therapy during pregnancy. Clinical Infectious Diseases 27 1151–1160. (https://doi.org/10.1086/514977)
Lamont RF, Møller Luef B & & Stener Jørgensen J 2020 Childhood inflammatory and metabolic disease following exposure to antibiotics in pregnancy, antenatally, intrapartum and neonatally. F1000Research 9 F1000 Faculty Rev-144. (https://doi.org/10.12688/f1000research.19954.1)
Lamousé-Smith ES, Tzeng A & & Starnbach MN 2011 The intestinal flora is required to support antibody responses to systemic immunization in infant and germ free mice. PLoS One 6 e27662. (https://doi.org/10.1371/journal.pone.0027662)
Larson JL, Wallace TL, Tyl RW, Marr MC, Myers CB & & Cossum PA 2000 The reproductive and developmental toxicity of the antifungal drug Nyotran® (liposomal nystatin) in rats and rabbits. Toxicological Sciences 53 421–429. (https://doi.org/10.1093/toxsci/53.2.421)
Lawn JE, Bahl R, Bergstrom S, Bhutta ZA, Darmstadt GL, Ellis M, English M, Kurinczuk JJ, Lee ACC, Merialdi M, et al.2011 Setting research priorities to reduce almost one million deaths from birth asphyxia by 2015. PLOS Medicine 8 e1000389. (https://doi.org/10.1371/journal.pmed.1000389)
Leclercq S, Mian FM, Stanisz AM, Bindels LB, Cambier E, Ben-Amram H, Koren O, Forsythe P & & Bienenstock J 2017 Low-dose penicillin in early life induces long-term changes in murine gut microbiota, brain cytokines and behavior. Nature Communications 8 15062. (https://doi.org/10.1038/ncomms15062)
Leke AZ, Dolk H, Loane M, Casson K, Nelen V, Barišić I, Garne E, Rissman A, O’Mahony M, Neville AJ, et al.2021 Macrolide and lincosamide antibiotic exposure in the first trimester of pregnancy and risk of congenital anomaly: a European case-control study. Reproductive Toxicology 100 101–108. (https://doi.org/10.1016/j.reprotox.2021.01.006)
Li P, Chang X, Chen X, Wang C, Shang Y, Zheng D & & Qi K 2022 Early-life antibiotic exposure increases the risk of childhood overweight and obesity in relation to dysbiosis of gut microbiota: a birth cohort study. Annals of Clinical Microbiology and Antimicrobials 21 46. (https://doi.org/10.1186/s12941-022-00535-1)
Luo Q, Pin T, Dai L, Chen G, Chen Y, Tian F & & Zhang M 2019 The role of S100B protein at 24 hours of postnatal age as early indicator of brain damage and prognostic parameter of perinatal asphyxia. Global Pediatric Health 6 2333794X19833729. (https://doi.org/10.1177/2333794X19833729)
Martín R, Rios-Covian D, Huillet E, Auger S, Khazaal S, Bermúdez-Humarán LG, Sokol H, Chatel J-M & & Langella P 2023 Faecalibacterium: a bacterial genus with promising human health applications. FEMS Microbiology Reviews 47 fuad039. (https://doi.org/10.1093/femsre/fuad039)
McGuire W 2007 Perinatal asphyxia. BMJ Clinical Evidence 2007 0320.
Michetti F, Corvino V, Geloso MC, Lattanzi W, Bernardini C, Serpero L & & Gazzolo D 2012 The S100B protein in biological fluids: more than a lifelong biomarker of brain distress. Journal of Neurochemistry 120 644–659. (https://doi.org/10.1111/j.1471-4159.2011.07612.x)
Morel C, Martinez Sanchez I, Cherifi Y, Chartrel N & & Diaz Heijtz R 2023 Perturbation of maternal gut microbiota in mice during a critical perinatal window influences early neurobehavioral outcomes in offspring. Neuropharmacology 229 109479. (https://doi.org/10.1016/j.neuropharm.2023.109479)
Muanda FT, Sheehy O & & Bérard A 2017 Use of antibiotics during pregnancy and the risk of major congenital malformations: a population based cohort study. British Journal of Clinical Pharmacology 83 2557–2571. (https://doi.org/10.1111/bcp.13364)
Nguyen AT, Armstrong EA & & Yager JY 2017 Neurodevelopmental reflex testing in neonatal rat pups. Journal of Visualized Experiments: JoVE (122). (https://doi.org/10.3791/55261)
Nyangahu DD, Lennard KS, Brown BP, Darby MG, Wendoh JM, Havyarimana E, Smith P, Butcher J, Stintzi A, Mulder N, et al.2018 Disruption of maternal gut microbiota during gestation alters offspring microbiota and immunity. Microbiome 6 124. (https://doi.org/10.1186/s40168-018-0511-7)
O’Connor R, Moloney GM, Fulling C, O’Riordan KJ, Fitzgerald P, Bastiaanssen TFS, Schellekens H, Dinan TG & & Cryan JF 2021 Maternal antibiotic administration during a critical developmental window has enduring neurobehavioural effects in offspring mice. Behavioural Brain Research 404 113156. (https://doi.org/10.1016/j.bbr.2021.113156)
Olmos G & & Lladó J 2014 Tumor necrosis factor alpha: a link between neuroinflammation and excitotoxicity. Mediators of Inflammation 2014 861231. (https://doi.org/10.1155/2014/861231)
Panaitescu AM, Isac S, Pavel B, Ilie AS, Ceanga M, Totan A, Zagrean L, Peltecu G, & Zagrean AM 2018. Oxytocin reduces seizure burden and hippocampal injury in a rat model of perinatal asphyxia. Acta Endocrinology 14 315–319. (https://doi.org/10.4183/aeb.2018.315).
Patangia DV, Anthony Ryan C, Dempsey E, Paul Ross R & & Stanton C 2022 Impact of antibiotics on the human microbiome and consequences for host health. MicrobiologyOpen 11 e1260. (https://doi.org/10.1002/mbo3.1260)
Prajescu B, Gavriliu L, Iesanu MI, Ioan A, Boboc AA, Boboc C & & Galos F 2023 Bacterial species and antibiotic resistance—A retrospective analysis of bacterial cultures in a pediatric hospital. Antibiotics 12 966. (https://doi.org/10.3390/antibiotics12060966)
Raza A, Ngieng SC, Sime FB, Cabot PJ, Roberts JA, Popat A, Kumeria T & & Falconer JR 2021 Oral meropenem for superbugs: challenges and opportunities. Drug Discovery Today 26 551–560. (https://doi.org/10.1016/j.drudis.2020.11.004)
Reikvam DH, Erofeev A, Sandvik A, Grcic V, Jahnsen FL, Gaustad P, McCoy KD, Macpherson AJ, Meza-Zepeda LA & & Johansen F-E 2011 Depletion of murine intestinal microbiota: effects on gut mucosa and epithelial gene expression. PLoS One 6 e17996. (https://doi.org/10.1371/journal.pone.0017996)
Ruhela RK, Soni S, Sarma P, Prakash A & & Medhi B 2019 Negative geotaxis: an early age behavioral hallmark to VPA rat model of autism. Annals of Neurosciences 26 25–31. (https://doi.org/10.5214/ans.0972.7531.260106)
Savignac HM, Tramullas M, Kiely B, Dinan TG & & Cryan JF 2015 Bifidobacteria modulate cognitive processes in an anxious mouse strain. Behavioural Brain Research 287 59–72. (https://doi.org/10.1016/j.bbr.2015.02.044)
Semple BD, Blomgren K, Gimlin K, Ferriero DM & & Noble-Haeusslein LJ 2013 Brain development in rodents and humans: identifying benchmarks of maturation and vulnerability to injury across species. Progress in Neurobiology 106–107 1–16. (https://doi.org/10.1016/j.pneurobio.2013.04.001)
Singh V, Lee G, Son H, Koh H, Kim ES, Unno T & & Shin J-H 2023 Butyrate producers, “The Sentinel of Gut”: their intestinal significance with and beyond butyrate, and prospective use as microbial therapeutics. Frontiers in Microbiology 13 1103836. (https://doi.org/10.3389/fmicb.2022.1103836)
Spichak S, Bastiaanssen TFS, Berding K, Vlckova K, Clarke G, Dinan TG & & Cryan JF 2021 Mining microbes for mental health: determining the role of microbial metabolic pathways in human brain health and disease. Neuroscience and Biobehavioral Reviews 125 698–761. (https://doi.org/10.1016/j.neubiorev.2021.02.044)
Stewardson AJ, Gaïa N, François P, Malhotra-Kumar S, Delémont C, Tejada de BM, Schrenzel J, Harbarth S & & Lazarevic V 2015 Collateral damage from oral ciprofloxacin versus nitrofurantoin in outpatients with urinary tract infections: a culture-free analysis of gut microbiota. Clinical Microbiology and Infection 21 344.e1–344.e11. (https://doi.org/10.1016/j.cmi.2014.11.016)
Straughen JK, Sitarik AR, Wegienka G, Cole Johnson C, Johnson-Hooper TM & & Cassidy-Bushrow AE 2023 Association between prenatal antimicrobial use and offspring attention deficit hyperactivity disorder. PLoS One 18 e0285163. (https://doi.org/10.1371/journal.pone.0285163)
Tamana SK, Tun HM, Konya T, Chari RS, Field CJ, Guttman DS, Becker AB, Moraes TJ, Turvey SE, Subbarao P, et al.2021 Bacteroides-dominant gut microbiome of late infancy is associated with enhanced neurodevelopment. Gut Microbes. 13 1–17. (https://doi.org/10.1080/19490976.2021.1930875)
Tao Q, Shen Y, Li Y, Luo H, Yuan M & & Gan J 2022 Prenatal exposure to antibiotics and risk of neurodevelopmental disorders in offspring: a systematic review and meta-analysis. Frontiers in Neurology 13 1045865. (https://doi.org/10.3389/fneur.2022.1045865)
Tochitani S, Ikeno T, Ito T, Sakurai A, Yamauchi T & & Matsuzaki H 2016 Administration of non-absorbable antibiotics to pregnant mice to perturb the maternal gut microbiota is associated with alterations in offspring behavior. PLoS One 11 e0138293. (https://doi.org/10.1371/journal.pone.0138293)
Tu X, Duan C, Lin B, Li K, Gao J, Yan H, Wang K & & Zhao Z 2022 Characteristics of the gut microbiota in pregnant women with fetal growth restriction. BMC Pregnancy and Childbirth 22 297. (https://doi.org/10.1186/s12884-022-04635-w)
Umana A, Sanders BE, Yoo CC, Casasanta MA, Udayasuryan B, Verbridge SS & & Slade DJ 2019 Reevaluating the fusobacterium virulence factor landscape. bioRxiv 534297. (https://doi.org/10.1101/534297)
Vuong HE, Pronovost GN, Williams DW, Coley EJL, Siegler EL, Qiu A, Kazantsev M, Wilson CJ, Rendon T & & Hsiao EY 2020 The maternal microbiome modulates fetal neurodevelopment in mice. Nature 586 281–286. (https://doi.org/10.1038/s41586-020-2745-3)
Wan L, Ge W-R, Zhang S, Sun Y-L, Wang B & & Yang G 2020 Case-control study of the effects of gut microbiota composition on neurotransmitter metabolic pathways in children with attention deficit hyperactivity disorder. Frontiers in Neuroscience 14 127. (https://doi.org/10.3389/fnins.2020.00127)
Wang I-K, Wu Y-Y, Yang Y-F, Ting I-W, Lin C-C, Yen T-H, Chen J-H, Wang C-H, Huang C-C & & Lin H-C 2015 The effect of probiotics on serum levels of cytokine and endotoxin in peritoneal dialysis patients: a randomised, double-blind, placebo-controlled trial. Beneficial Microbes 6 423–430. (https://doi.org/10.3920/BM2014.0088)
Wang L, Xie Z, Li G, Li G & & Liang J 2023 Two-sample Mendelian randomization analysis investigates causal associations between gut microbiota and attention deficit hyperactivity disorder. Frontiers in Microbiology 14 1144851. (https://doi.org/10.3389/fmicb.2023.1144851)
Wuputra K, Tsai M-H, Kato K, Yang Y, Pan J-B, Ku C-C, Noguchi M, Kishikawa S, Nakade K, Chen H-L, et al.2022 Dimethyl sulfoxide stimulates the AhR-Jdp2 axis to control ROS accumulation in mouse embryonic fibroblasts. Cell Biology and Toxicology 38 203–222. (https://doi.org/10.1007/s10565-021-09592-2)
Xi Y, Jing Z, Wei W, Chun Z, Quan Q, Qing Z, Jiamin X & & Shuwen H 2021 Inhibitory effect of sodium butyrate on colorectal cancer cells and construction of the related molecular network. BMC Cancer 21 127. (https://doi.org/10.1186/s12885-021-07845-1)
Yang LL, Millischer V, Rodin S, MacFabe DF, Villaescusa JC & & Lavebratt C 2020 Enteric short-chain fatty acids promote proliferation of human neural progenitor cells. Journal of Neurochemistry 154 635–646. (https://doi.org/10.1111/jnc.14928)
Yoo DY, Kim W, Nam SM, Kim DW, Chung JY, Choi SY, Yoon YS, Won M-H & & Hwang IK 2011 Synergistic effects of sodium butyrate, a histone deacetylase inhibitor, on increase of neurogenesis induced by pyridoxine and increase of neural proliferation in the mouse dentate gyrus. Neurochemical Research 36 1850–1857. (https://doi.org/10.1007/s11064-011-0503-5)
Yuan Q, Gong H, Du M, Li T & & Mao X 2022 Milk fat globule membrane supplementation to obese rats during pregnancy and lactation promotes neurodevelopment in offspring via modulating gut microbiota. Frontiers in Nutrition 9. (https://doi.org/10.3389/fnut.2022.945052)
Zagrean A-M, Georgescu I-A, Iesanu MI, Ionescu R-B, Haret RM, Panaitescu AM & & Zagrean L 2022. Chapter Three Oxytocin and vasopressin in the hippocampus. In Vitamins and Hormones, vol. 118. Litwack G, Ed. Academic Press . (Hormones, Regulators and Hippocampus), pp. 83–127. . (https://doi.org/10.1016/bs.vh.2021.11.002)
Zarrinpar A, Chaix A, Yooseph S & & Panda S 2014 Diet and feeding pattern affect the diurnal dynamics of the gut microbiome. Cell Metabolism 20 1006–1017. (https://doi.org/10.1016/j.cmet.2014.11.008)
Zhou Y, Chen C, Yu H & & Yang Z 2020 Fecal microbiota changes in patients with postpartum depressive disorder. Frontiers in Cellular and Infection Microbiology 10 567268. (https://doi.org/10.3389/fcimb.2020.567268)
Zimmermann P & & Curtis N 2019 The effect of antibiotics on the composition of the intestinal microbiota - a systematic review. Journal of Infection 79 471–489. (https://doi.org/10.1016/j.jinf.2019.10.008)
